(PACK OF 3) Action Can CD-90 Chain & Drive Lubricant - Heavy Duty Chain Lube Spray
FREE Shipping
(PACK OF 3) Action Can CD-90 Chain & Drive Lubricant - Heavy Duty Chain Lube Spray
- Brand: Unbranded
Description
Gronthos S, Mankani M, Brahim J, Robey PG, Shi S. Postnatal human dental pulp stem cells (DPSCs) in vitro and in vivo. Proc Natl Acad Sci U S A. 2000;97:13625–30. doi: 10.1073/pnas.240309797.
Yu J, Wang Y, Deng Z, Tang L, Li Y, Shi J, et al. Odontogenic capability: bone marrow stromal stem cells versus dental pulp stem cells. Biol Cell. 2007;99:465–74. Davies OG, Cooper PR, Shelton RM, Smith a J, Scheven BA. A comparison of the in vitro mineralisation and dentinogenic potential of mesenchymal stem cells derived from adipose tissue, bone marrow and dental pulp. J Bone Miner Metab. 2014;371–82.
Krampera M, Pasini A, Rigo A, Scupoli MT, Tecchio C, Malpeli G, et al. HB-EGF/HER-1 signaling in bone marrow mesenchymal stem cells: inducing cell expansion and reversibly preventing multilineage differentiation. Blood. 2005;106:59–66. doi: 10.1182/blood-2004-09-3645. Nakamura Y, Muguruma Y, Yahata T, Miyatake H, Sakai D, Mochida J, Hotta T, Ando K (2006). "Expression of CD90 on keratinocyte stem/progenitor cells". Br. J. Dermatol. 154 (6): 1062–70. doi: 10.1111/j.1365-2133.2006.07209.x. PMID 16704635. S2CID 28647667. Hiwase SD, Dyson PG, To LB, Lewis ID. Cotransplantation of placental mesenchymal stromal cells enhances single and double cord blood engraftment in nonobese diabetic/severe combined immune deficient mice. Stem Cells. 2009;27:2293–300. doi: 10.1002/stem.157. CD90 has been linked to the spindle-shape of lung fibroblasts. Observing lung fibroblasts sorted on the basis of CD90 expression, Phipps and co-workers [ 76] affirmed that the lung CD90 – fibroblast subpopulation showed a more polygonal shape than the spindle-shaped CD90 + fibroblasts. In contrast to these observations, in our study, a reduction in CD90 expression in shRNA CD90 MSCs and CD90-negative MSCs did not present altered morphology or proliferation rate when compared to control cells (Fig. 3). Here, we also demonstrated that a reduced expression of CD90 does not affect the immunosuppressive activity of MSCs on lymphocyte proliferation in vitro (Fig. 5), a very important therapeutic MSC property.
James AW. Review of signaling pathways governing MSC osteogenic and adipogenic differentiation. Scientifica. 2013;2013:1–17. doi: 10.1155/2013/684736. Zuk PA, Zhu M, Ashjian P, De Ugarte DA, Huang JI, Mizuno H, et al. Human adipose tissue is a source of multipotent stem cells. Mol Biol Cell. 2002;13:4279–95. doi: 10.1091/mbc.E02. Shih DT, Lee D, Chen S, Tsai R, Huang C. Isolation and characterization of neurogenic mesenchymal stem cells in human scalp tissue. Stem Cells. 2005;23:1012–20. doi: 10.1634/stemcells.2004-0125. Majeti R, Park CY, Weissman IL (December 2007). "Identification of a Hierarchy of Multipotent Hematopoietic Progenitors in Human Cord Blood". Cell Stem Cell. 1 (6): 635–45. doi: 10.1016/j.stem.2007.10.001. PMC 2292126. PMID 18371405. Kemshead JT, Ritter MA, Cotmore SF, Greaves MF (1982). "Human Thy-1: expression on the cell surface of neuronal and glial cells". Brain Res. 236 (2): 451–61. doi: 10.1016/0006-8993(82)90727-2. PMID 6121610. S2CID 25024190.
Conclusion
Total RNA was extracted from MSCs using Illustra RNAspin Mini (GE Healthcare), according to the manufacturer's guidelines. cDNA was prepared with High-Capacity cDNA Reverse Transcription (Applied Biosystems) and used as templates for polymerase chain reaction (PCR). The Kit Power Up SYBR Green Master Mix (Applied Biosystems) was used to quantify CD90 gene expression by quantitative real-time (qRT)-PCR under conditions recommended by the manufacturer and using the following primers: CACCCTCTCCGCACACCT (forward) and CCCCACCATCCCACTACC (reverse). For normalization of the data, the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA was used (forward primer: AGAAGGCTGGGGCTCATTTG; reverse primer: AGGGGCCATCCACAGTCTTC). qRT-PCR was performed with the StepOne Plus Real-Time PCR System. A standard curve was generated for each primer pair, and genes of interest were assigned a relative expression value interpolated from the standard curve using the threshold cycle. All expression values were normalized against GAPDH. All amplifications were done in triplicate. Magnetic separation of the MSCs for negative selection of CD90 Sibov TT, Severino P, Marti LC, Pavon LF, Oliveira DM, Tobo PR, et al. Mesenchymal stem cells from umbilical cord blood: parameters for isolation, characterization and adipogenic differentiation. Cytotechnology. 2012;64:511–21. doi: 10.1007/s10616-012-9428-3. Peripheral blood mononuclear cells were isolated from peripheral blood and separated using the standard method with Ficoll-Paque PLUS (Amersham Biosciences, Uppsala, Sweden). The mononuclear cells were washed twice with PBS buffer. Cells were then counted in an automated cell counter (2.0 Scepter, Millipore), resuspended to a final concentration of 10 4 cells/ml and labelled with CFSE (Sigma-Aldrich). The CFSE was adjusted to a final concentration of 5 μM and incubated for 10 min at 37 °C. The reaction was stopped by adding RPMI with 10 % FBS. In immediate succession, 2 × 10 4 lymphocytes were cultured with or without 5 × 10 4 MSCs previously adhered to the bottom of a 24-well plate in a total volume of 1 ml per well of RPMI with 10 % FBS medium. To evaluate the lymphocyte proliferation rate in the presence of MSCs, cell suspensions were activated with a phytohaemagglutinin (PHA; Sigma, USA) stimulus at a final concentration of 1 μg/ml in cell culture and maintained at 37 °C with 5 % CO 2 for 5 days for subsequent assessment by flow cytometry (CyFlowSpace-Partec, Germany) and the FlowJo analysis software (TreeStar) [ 53]. Suspension cells were stained with CD8-PE antibody (Biosciences), and lymphocyte proliferation was measured according to CFSE staining on gated population. In vitro differentiation assays Human PubMed Reference:". National Center for Biotechnology Information, U.S. National Library of Medicine.
Barker TH, Hagood JS. Getting a grip on Thy-1 signaling. Biochim Biophys Acta. 2009;1793:921–3. doi: 10.1016/j.bbamcr.2008.10.004.Roxio has tools to author DVDs, such as customizable menus and chapters. And like Nero Burning ROM, you can add artist metadata and album covers to your CDs with Gracenote® technology. With this CD burning software, you can also burn photos to a disc, and create and burn ISO image files. Erices A, Conget P, Minguell J. Mesenchymal progenitor cells in human umbilical cord blood. Br J Haematol. 2000;109:235–42. Wetzel A, Chavakis T, Preissner KT, Sticherling M, Haustein UF, Anderegg U, Saalbach A (2004). "Human Thy-1 (CD90) on activated endothelial cells is a counterreceptor for the leukocyte integrin Mac-1 (CD11b/CD18)". J. Immunol. 172 (6): 3850–9. doi: 10.4049/jimmunol.172.6.3850. PMID 15004192. Yamamoto T, Wilson CB (1987). "Quantitative and qualitative studies of antibody-induced mesangial cell damage in the rat". Kidney Int. 32 (4): 514–25. doi: 10.1038/ki.1987.240. PMID 2892961.
Patki S, Kadam S, Chandra V, Bhonde R. Human breast milk is a rich source of multipotent mesenchymal stem cells. Hum Cell. 2010;23:35–40. doi: 10.1111/j.1749-0774.2010.00083.x. Wide Format Support: Support for CD, DVD, Blu-ray, Double Layer discs, M-Disc, and extra large capacity DVD and Blu-ray Maleki M, Ghanbarvand F, Behvarz MR, Ejtemaei M, Ghadirkhomi E. Comparison of mesenchymal stem cell markers in multiple human adult stem cells. Int J Stem Cells. 2014;7:118–26.He J, Liu Y, Zhu T, Zhu J, DiMeco F, Vescovi AL, et al. CD90 is identified as a candidate marker for cancer stem cells in primary high-grade gliomas using tissue microarrays. Mol Cell Proteomics. 2012;11:M111.010744–4. doi: 10.1074/mcp.M111.010744. Common side effects seen with this medicine include headache, constipation, dizziness, fatigue, nausea, flushing, and rash. These are usually mild and disappear after a short time. Consult your doctor if they bother you or do not go away. It may also make you feel sleepy or dizzy, so be careful if you drive or do anything that requires you to be alert. Drinking alcohol should be avoided while taking this medicine as it may worsen the side effects. Williams AF, Gagnon J. Neuronal cell Thy-1 glycoprotein: homology with immunoglobulin. Science. 1982;216:696–703. Bradley JE, Ramirez G, Hagood JS. Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 2009;35:258–65. doi: 10.1002/biof.41.
- Fruugo ID: 258392218-563234582
- EAN: 764486781913
-
Sold by: Fruugo